Mung Beans: From Dinner Table to Lab Bench

So today I was doing an experiment, and realized the tube I was pipetting from was a perfect plant topic: mung bean nuclease!

You know mung beans.  You’ve probably eaten them recently, especially if you like Asian food or if you’re on a strict diet.  Mung bean sprouts are the popular white bean sprouts found in every grocery store, and their crisp crunch is a familiar texture in stir-fries, spring rolls and salads. Although they’re native to India, their use is widespread across Asian cuisine.  The beans’ starch is used to make bean thread noodles, and the beans themselves are used to make the paste that fills Chinese mooncakes, or for some kinds of the Indian dish dal (although I’m used to the lentil variety.  Has anyone had mung bean dal—does it taste similar?).

Mung bean sprouts. Fresh, crisp, tasty, and chock-full of nuclease. (Open source photo by Kwantonge).

But mung beans are also a surprising component of every molecular biologist’s toolkit, because they produce a useful enzyme (mung bean nuclease).  There are quite a lot of applications for which this handy tool can be used, but I generally use it for cutting away dangling single-stranded tails of DNA.  A huge, huge part of practical molecular biology is playing cut-and-paste with DNA: I have a piece of DNA over here, and I want to put it into a different piece of DNA over there.  This requires the molecular equivalent of scissors and glue—something that will cut DNA apart, and something else that will glue it back together.  Mung bean nuclease is a very specialized pair of molecular scissors.

Any other favorite uses from the biologists out there?

On my bench: a few precious drops of molecular scissors.

Extra nitty-gritty:

DNA, whether bacterial, plant, or human, comes as a double-stranded helix: one strand of letters on one side and another strand on the other side, A’s always paired with T’s and G’s always paired with C’s.

GGGCACCTGTCTAGACGGAATGGTG

CCCGTGGACAGACTCGCCTTACCAC

What I wanted to do today was take two genes that were right next to each other on a long piece of DNA, and bring them closer together by exactly 1 or exactly 4 letters (if you’re a biology afficionado and you’re curious, what I was trying to do was shift the reading frame of one gene to be the same as the other gene, so that they’d be read as a single fused protein).

<—-gene 1             gene 2—->

GGGCACCTGTCTAGACGGAATGGTG

CCCGTGGACAGACTCGCCTTACCAC

Cutting a defined number of letters out of the middle of a solid piece of DNA can be tricky, and there are several ways to do it.  In this case I was fortunate, because right between my two genes was a sequence of letters: TCTAGA, that’s specifically cut into by an enzyme called Xba1, a restriction endonuclease (so called because the kind of sequence it can cut is restricted to just TCTAGA).  XbaI, like many restriction endonucleases, cuts in a zigzag fashion, leaving 4 letters (CTAG) hanging over the edge on each side, unpaired and single-stranded instead of double-stranded:

Starting DNA:

GGGCACCTGTCTAGACGGAATGGTG

CCCGTGGACAGACTCGCCTTACCAC

+ XbaI =

GGGCACCTGT       CTAGACGGAATGGTG

CCCGTGGACAGATC      TGCCTTACCAC

Here’s where mung bean nuclease comes in.  When I add mung bean nuclease to these XbaI-cut pieces, it will chew off the unpaired single stranded tails from both sides:

XbaI-cut DNA:

GGGCACCTGT       CTAGACGGAATGGTG

CCCGTGGACAGATC      TGCCTTACCAC

+ Mung bean nuclease =

GGGCACCTGT      ACGGAATGGTG

CCCGTGGACA      TGCCTTACCAC

Now, when I paste the two ends back together (with a different enzyme, ligase), the result will be exactly 4 letters shorter than the piece I started with.  Victory!

Starting DNA:

GGGCACCTGTCTAGACGGAATGGTG  (25 letters shown)

CCCGTGGACAGACTCGCCTTACCAC

After XbaI, mung bean nuclease, and ligase:

GGGCACCTGTACGGAATGGTG  (21 letters shown)

CCCGTGGACATGCCTTACCAC

Mung bean nuclease is handy anytime you need to get rid of single-stranded DNA (or RNA), so another common use is when you have two bits of DNA you need to put together that have jagged single-stranded ends that don’t match.  Mung bean nuclease will crop off the single-stranded ends, leaving smooth, blunt double stranded ends that join nicely.

Advertisements

One thought on “Mung Beans: From Dinner Table to Lab Bench

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Google+ photo

You are commenting using your Google+ account. Log Out / Change )

Connecting to %s